Mu 185

From MycoWiki
Revision as of 15:04, 8 September 2017 by Bdentinger (talk | contribs) (CSV import)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Back to Main Page
Back to Sarawakfungi
Back to Sarawak collections gallery

CURRENT NAME: Trametes is this 186 from FTA card?
Determiner: missing
Name registration:
All images © Bryn Dentinger

400px 400px 400px 400px 400px

Voucher Information

K(M)

TRTC


History of Name Changes

missing


Location

missing

Latitude

missing

Longitude

missing

Elevation (m)

missing

Reference

Gunung Mulu National Park

Country

Sarawak

Habitat

missing

Substrate

missing


Collection Information

Collection date

missing

Collected by

missing


DNA Sequences

ITS

CATTATTGAATCAAAATTAGGTTGAGGTTGTTAAGCTGGCTTCAGTGACGTGGAGCACGTGCACGCCTTGCCTTGTTTCAATTGCCCTCTACACCCTTTGTGCACTTCTCACAGGTTCTGAATTGTCTCGTCTGAAACACGACGACACTTTTTTTTTCTCCTGTGTGTCACCATACACGTGTTTGTTTCTCAGAATGTTACTTGTTGTTGCACATCATTGCATGGGATGGTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTTTGGTATTTCCAGGAGCATGCCTGTTTGAGTGTCACGGTATTTCTCAACCTTTCTTCACTGTTGTGGTTCAACACAGTTTTTGGAGGGAAGGGGTTGGACTTGGAGGTTCGTTGCTGGTTTCGTTTCACTTGTTTGAAACATCTTCGGCTCCTCTAAAATACATAAGCTTGGACAATGATTTTTACTGGGCGTGATTCGATGTGATAAATGTTTTGTATCGCTTCATGTTTCCAGTTTCATTTCATGTCACTTGGCTTGTTCAGGCTTGTTGATCGTTCTGTCTTGGACGTCACCTCGAACATCTGACCT

BLAST ITS against GenBank[1]




LSU

BLAST LSU against GenBank[2]




Diagnosis

Notes

missing